ID: 937003607_937003610

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 937003607 937003610
Species Human (GRCh38) Human (GRCh38)
Location 2:118490819-118490841 2:118490841-118490863
Sequence CCTTTCTTTGAGCAACTTGTGCC CAGTACCGCAACAGGCAGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!