ID: 937004108_937004115

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 937004108 937004115
Species Human (GRCh38) Human (GRCh38)
Location 2:118495885-118495907 2:118495902-118495924
Sequence CCCTTCACCCTTTGCCTAAATTG AAATTGGTAATTTTAACTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 34, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!