ID: 937031688_937031701

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 937031688 937031701
Species Human (GRCh38) Human (GRCh38)
Location 2:118746048-118746070 2:118746097-118746119
Sequence CCTCCCACTGTGTCCCTCTCATG TTCAAGATGAGATTTGGGTGGGG
Strand - +
Off-target summary {0: 3, 1: 72, 2: 728, 3: 1442, 4: 3188} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!