ID: 937031688_937031701 |
View in Genome Browser |
Spacer: 26 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 937031688 | 937031701 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 2:118746048-118746070 | 2:118746097-118746119 |
Sequence | CCTCCCACTGTGTCCCTCTCATG | TTCAAGATGAGATTTGGGTGGGG |
Strand | - | + |
Off-target summary | {0: 3, 1: 72, 2: 728, 3: 1442, 4: 3188} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |