ID: 937062719_937062730

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 937062719 937062730
Species Human (GRCh38) Human (GRCh38)
Location 2:118992342-118992364 2:118992372-118992394
Sequence CCCTCCACCCGCTCCCCACTCAT CAGGCAAAGGCGTCCTGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 621} {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!