ID: 937070816_937070825

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 937070816 937070825
Species Human (GRCh38) Human (GRCh38)
Location 2:119061753-119061775 2:119061799-119061821
Sequence CCTGTGAATGCAACCAAGAGACA CGCTGGGGGAACTGAAACCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!