ID: 937080661_937080668

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 937080661 937080668
Species Human (GRCh38) Human (GRCh38)
Location 2:119137424-119137446 2:119137466-119137488
Sequence CCTCCCCCCATTTGCTTATAGAT ATACTTTAAAAAAATCTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 169} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!