ID: 937111566_937111572

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 937111566 937111572
Species Human (GRCh38) Human (GRCh38)
Location 2:119370745-119370767 2:119370767-119370789
Sequence CCCGGGATGTTGGACTTCACGGG GCAAGGCCAAGTGGGATGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77} {0: 1, 1: 1, 2: 0, 3: 21, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!