ID: 937153762_937153775

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 937153762 937153775
Species Human (GRCh38) Human (GRCh38)
Location 2:119703676-119703698 2:119703722-119703744
Sequence CCCGACTCCCTTCCCCTCTGGCT AGACACCAGCAGAAGATGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 57, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!