ID: 937203869_937203876

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 937203869 937203876
Species Human (GRCh38) Human (GRCh38)
Location 2:120223509-120223531 2:120223526-120223548
Sequence CCTCCCCGCGCTCGCCGCGGCTT CGGCTTCCCGGGAACCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 206} {0: 1, 1: 0, 2: 1, 3: 8, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!