ID: 937221675_937221692

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 937221675 937221692
Species Human (GRCh38) Human (GRCh38)
Location 2:120345930-120345952 2:120345966-120345988
Sequence CCGCCCGGCGCGCCCCTCGGGCC GCGCCCCTTCCCTGCCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 342} {0: 1, 1: 0, 2: 0, 3: 28, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!