ID: 937222548_937222552

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 937222548 937222552
Species Human (GRCh38) Human (GRCh38)
Location 2:120350132-120350154 2:120350146-120350168
Sequence CCACCCACACAGCAGCCTCCAGG GCCTCCAGGATACCAGCAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 86, 4: 664} {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!