ID: 937244482_937244490

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 937244482 937244490
Species Human (GRCh38) Human (GRCh38)
Location 2:120483739-120483761 2:120483759-120483781
Sequence CCACATGCTCTCTCTCCCTGCGT CGTGGGGAGGCCATCATCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 663} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!