ID: 937292074_937292087

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 937292074 937292087
Species Human (GRCh38) Human (GRCh38)
Location 2:120787748-120787770 2:120787794-120787816
Sequence CCCTCTGCTGGGTCAGCGGTGCT CCCTGGACCTCTAGGCTTCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!