ID: 937294207_937294214

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 937294207 937294214
Species Human (GRCh38) Human (GRCh38)
Location 2:120799915-120799937 2:120799952-120799974
Sequence CCCCCTCAGGGGCGGGGATGCTC AGGTCTCAGCATCTGGTGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!