ID: 937359414_937359423

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 937359414 937359423
Species Human (GRCh38) Human (GRCh38)
Location 2:121218615-121218637 2:121218655-121218677
Sequence CCAGCTGGGGCCCAAGCACTGAC TCCCATCAGCTGCCCTGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 230} {0: 1, 1: 0, 2: 2, 3: 36, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!