ID: 937369005_937369022

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 937369005 937369022
Species Human (GRCh38) Human (GRCh38)
Location 2:121284997-121285019 2:121285041-121285063
Sequence CCGGCCCGCCGGCCCGGCCCGAG CCCTTACCGCAGGTAGCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 503} {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!