ID: 937376278_937376286

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 937376278 937376286
Species Human (GRCh38) Human (GRCh38)
Location 2:121337979-121338001 2:121338019-121338041
Sequence CCCACCCAACCTGGGGGTGTGGG CAGTGCCAACATAACTATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 212} {0: 1, 1: 0, 2: 0, 3: 4, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!