ID: 937414050_937414059

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 937414050 937414059
Species Human (GRCh38) Human (GRCh38)
Location 2:121700174-121700196 2:121700205-121700227
Sequence CCGGATCAACGCCCTGGACCTCA TGAGGAACCAGTGGGAAGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 48, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!