ID: 937485196_937485206

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 937485196 937485206
Species Human (GRCh38) Human (GRCh38)
Location 2:122308388-122308410 2:122308436-122308458
Sequence CCTGCTGCTCTTCTCGGCTGAGG ACAGTTGCCCTTGGACAGGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!