ID: 937609333_937609338

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 937609333 937609338
Species Human (GRCh38) Human (GRCh38)
Location 2:123840985-123841007 2:123840999-123841021
Sequence CCCCACAGCATTCCTGTGCAGAG TGTGCAGAGATCTTGGTACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 24, 2: 60, 3: 99, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!