ID: 937739180_937739184

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 937739180 937739184
Species Human (GRCh38) Human (GRCh38)
Location 2:125329469-125329491 2:125329504-125329526
Sequence CCATTTAAAAGATGAACATGCTG TCTTGAAGGTAAATTCTGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 19, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!