ID: 937845388_937845398

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 937845388 937845398
Species Human (GRCh38) Human (GRCh38)
Location 2:126573529-126573551 2:126573575-126573597
Sequence CCTTTTCCATGCCTCAGTGGCCT CTTTGCCCCAGTGCAGTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 55, 4: 488} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!