ID: 937845396_937845398

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 937845396 937845398
Species Human (GRCh38) Human (GRCh38)
Location 2:126573562-126573584 2:126573575-126573597
Sequence CCTCTTTCTATGCCTTTGCCCCA CTTTGCCCCAGTGCAGTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 373} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!