ID: 937914577_937914584

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 937914577 937914584
Species Human (GRCh38) Human (GRCh38)
Location 2:127092621-127092643 2:127092642-127092664
Sequence CCCACTGACCCGCAGCCCCGGGC GCAAGTCACCAGCCTTCCAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 23, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!