ID: 937927899_937927906

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 937927899 937927906
Species Human (GRCh38) Human (GRCh38)
Location 2:127182064-127182086 2:127182077-127182099
Sequence CCTGAGAGCCTAGGGTGGGAGTG GGTGGGAGTGGGGTAGGGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 9, 3: 206, 4: 1596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!