ID: 937950998_937951011

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 937950998 937951011
Species Human (GRCh38) Human (GRCh38)
Location 2:127387913-127387935 2:127387959-127387981
Sequence CCCTCGTCAGGCGCCGCCGCTGA ACACACGGACCCGTGACGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54} {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!