ID: 937951003_937951010

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 937951003 937951010
Species Human (GRCh38) Human (GRCh38)
Location 2:127387926-127387948 2:127387958-127387980
Sequence CCGCCGCTGAGGGCAGGCAGCCC TACACACGGACCCGTGACGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 239} {0: 1, 1: 0, 2: 0, 3: 0, 4: 10}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!