ID: 937951003_937951011

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 937951003 937951011
Species Human (GRCh38) Human (GRCh38)
Location 2:127387926-127387948 2:127387959-127387981
Sequence CCGCCGCTGAGGGCAGGCAGCCC ACACACGGACCCGTGACGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 239} {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!