ID: 937957350_937957357

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 937957350 937957357
Species Human (GRCh38) Human (GRCh38)
Location 2:127428786-127428808 2:127428804-127428826
Sequence CCTTCCACGGCACCTGGTTCCTG TCCTGGTGGGCCTGGTGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185} {0: 1, 1: 2, 2: 3, 3: 41, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!