ID: 937957350_937957359

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 937957350 937957359
Species Human (GRCh38) Human (GRCh38)
Location 2:127428786-127428808 2:127428805-127428827
Sequence CCTTCCACGGCACCTGGTTCCTG CCTGGTGGGCCTGGTGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185} {0: 1, 1: 1, 2: 9, 3: 44, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!