ID: 937974872_937974885

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 937974872 937974885
Species Human (GRCh38) Human (GRCh38)
Location 2:127576583-127576605 2:127576633-127576655
Sequence CCTCCCTCCCAGGCTCCCGAGGA GCTCATGGGGGTGAGTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 569} {0: 1, 1: 0, 2: 3, 3: 26, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!