ID: 937984702_937984710

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 937984702 937984710
Species Human (GRCh38) Human (GRCh38)
Location 2:127633249-127633271 2:127633270-127633292
Sequence CCCCCTCAGGACGGGGCCCCGGA GAAGCAGCCCCCGCACCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 126} {0: 1, 1: 0, 2: 0, 3: 19, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!