ID: 937996462_937996467

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 937996462 937996467
Species Human (GRCh38) Human (GRCh38)
Location 2:127698243-127698265 2:127698271-127698293
Sequence CCTTTGCATCTCCATCCACATCA CACTGTGAATGGAGCCCAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 21, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!