ID: 938003320_938003323

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 938003320 938003323
Species Human (GRCh38) Human (GRCh38)
Location 2:127764958-127764980 2:127764988-127765010
Sequence CCCTCACTGGGCTGTCGTGAGCC GCAGAAAACATTAATTAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 205} {0: 1, 1: 0, 2: 1, 3: 22, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!