ID: 938022144_938022153

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 938022144 938022153
Species Human (GRCh38) Human (GRCh38)
Location 2:127914857-127914879 2:127914897-127914919
Sequence CCACTTTTGGCCAGGCAGAGTGG AGCACTTTGGGAGGCTGAGACGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 30, 3: 250, 4: 1008} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!