ID: 938030332_938030337

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 938030332 938030337
Species Human (GRCh38) Human (GRCh38)
Location 2:127986805-127986827 2:127986821-127986843
Sequence CCGGAGTATGCTTGGCCGTGGCG CGTGGCGATGAGCCCTGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 27} {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!