ID: 938052804_938052814

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 938052804 938052814
Species Human (GRCh38) Human (GRCh38)
Location 2:128190635-128190657 2:128190660-128190682
Sequence CCATACTCAGCCCCTCTCGCATC GCCCGTCAGGGTCAGGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 187} {0: 1, 1: 1, 2: 1, 3: 39, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!