ID: 938070646_938070653

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 938070646 938070653
Species Human (GRCh38) Human (GRCh38)
Location 2:128306554-128306576 2:128306602-128306624
Sequence CCTAGGGGCTGTAAACATTTGTT CTTTCTAATTCTCAGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!