ID: 938101464_938101469

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 938101464 938101469
Species Human (GRCh38) Human (GRCh38)
Location 2:128500564-128500586 2:128500614-128500636
Sequence CCCTGGCCATTCAGAAAAAATTT GCTTAGGGATGCAACCGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 32, 4: 388} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!