ID: 938109116_938109121

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 938109116 938109121
Species Human (GRCh38) Human (GRCh38)
Location 2:128552465-128552487 2:128552479-128552501
Sequence CCACCCCAGGCCTGCTGAATCAG CTGAATCAGCACCTCTATACTGG
Strand - +
Off-target summary {0: 4, 1: 55, 2: 273, 3: 881, 4: 2028} {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!