ID: 938139390_938139404

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 938139390 938139404
Species Human (GRCh38) Human (GRCh38)
Location 2:128783636-128783658 2:128783679-128783701
Sequence CCCCCCAGAGCATATACAGTGTT ACCATGGTTTCCACTCTCAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!