ID: 938183662_938183665

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 938183662 938183665
Species Human (GRCh38) Human (GRCh38)
Location 2:129207998-129208020 2:129208020-129208042
Sequence CCAGCACTTTTGGAGGCTGAGGC CGGGTAGATTACCTGAAGTCAGG
Strand - +
Off-target summary No data {0: 3, 1: 112, 2: 3005, 3: 31714, 4: 98978}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!