ID: 938248696_938248708

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 938248696 938248708
Species Human (GRCh38) Human (GRCh38)
Location 2:129797640-129797662 2:129797671-129797693
Sequence CCAGGGCCCAGCCAGAATTCAGG AGCAGGGGCAGAAGTGGATAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 42, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!