ID: 938261128_938261140

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 938261128 938261140
Species Human (GRCh38) Human (GRCh38)
Location 2:129895838-129895860 2:129895863-129895885
Sequence CCCACCACAGCATCCAGTGATCG CATGGCATGGGGGCCTGTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 29, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!