ID: 938263171_938263187

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 938263171 938263187
Species Human (GRCh38) Human (GRCh38)
Location 2:129909566-129909588 2:129909602-129909624
Sequence CCCTCCCCACTGTCCACCCCCAC TCCCAAAGCCCACTCCACTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!