ID: 938263174_938263189

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 938263174 938263189
Species Human (GRCh38) Human (GRCh38)
Location 2:129909571-129909593 2:129909603-129909625
Sequence CCCACTGTCCACCCCCACCCCAT CCCAAAGCCCACTCCACTGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 116, 4: 758} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!