ID: 938279056_938279066

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 938279056 938279066
Species Human (GRCh38) Human (GRCh38)
Location 2:130051837-130051859 2:130051870-130051892
Sequence CCTGCTGGCTGACACTGGAAAAG GAGAATGGGGAGCACAAGGCTGG
Strand - +
Off-target summary {0: 4, 1: 7, 2: 10, 3: 28, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!