ID: 938292565_938292574

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 938292565 938292574
Species Human (GRCh38) Human (GRCh38)
Location 2:130157829-130157851 2:130157878-130157900
Sequence CCTCCCAAGTGTGTGCAGAAAGC GACCTGTAATTCCAGCACTTTGG
Strand - +
Off-target summary No data {0: 16, 1: 3808, 2: 94655, 3: 320956, 4: 241482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!