ID: 938292565_938292575

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 938292565 938292575
Species Human (GRCh38) Human (GRCh38)
Location 2:130157829-130157851 2:130157879-130157901
Sequence CCTCCCAAGTGTGTGCAGAAAGC ACCTGTAATTCCAGCACTTTGGG
Strand - +
Off-target summary No data {0: 3111, 1: 86006, 2: 313232, 3: 241847, 4: 148165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!