ID: 938292572_938292577

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 938292572 938292577
Species Human (GRCh38) Human (GRCh38)
Location 2:130157861-130157883 2:130157882-130157904
Sequence CCAGGTGTGGTGCCTCAGACCTG TGTAATTCCAGCACTTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 82, 2: 5612, 3: 31619, 4: 96225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!